A total of 10 randomly selected bacterial colonies were subjected to colony PCR using a vector-specific primer T7Up-F (5 GATCCCGCGAAATTAATACG 3) and an insert-specific primer P24-R (5 GTGGAGCTCCAAAACTCTTGC 3)
A total of 10 randomly selected bacterial colonies were subjected to colony PCR using a vector-specific primer T7Up-F (5 GATCCCGCGAAATTAATACG 3) and an insert-specific primer P24-R (5 GTGGAGCTCCAAAACTCTTGC 3). aerobically grown in LB broth (10 g L-1 bacto-tryptone; 5 g L-1 yeast extract; 5 g L-1 NaCl; pH 7.0) or on LB agar (10 g L-1 bacto-tryptone; 5 g L-1 yeast extract; 5 g L-1 NaCl; 15 g L-1 Agar; pH 7.0) at various temperatures and in the absence or presence of Ampicillin (100 g mL-1) and/or Chloramphenicol (25 g mL-1). Bacterial strains were stored in LB broth plus 50% glycerol at -80C. In some experiments, NiCo21(DE3) were transformed with rare tRNA supplementing Rabbit Polyclonal to GPR113 plasmids pACYC-RIL (Stratagene), pRARE2 (Novagen), and pLysSRARE2 (Novagen). In some experiments, NiCo21(DE3) were grown in M9 broth (0.5 g L-1 NaCl; 1 g L-1 NH4Cl; 3 g L-1 G007-LK KH2PO4; 6.78 g L-1 Na2HPO4.; 2 mM MgSO4; 0.1 mM CaCl2; 10 g L-1 glucose. pH 7.0), Super broth (32 g L-1 bacto-tryptone; 20 g L-1 yeast extract; 5 g L-1 NaCl; pH 7.0), or Terrific broth (12 g L-1 bacto-tryptone; 24 g L-1 yeast extract; 8 mL L-1 glycerol; 2.2 g L-1 KH2PO4; 9.4 g L-1 K2HPO4. pH 7.0). Construction of plasmid expressing HIV-1 CA (pSA-HP24-6His) Construction scheme of pSA-Hp24-6His is given in Figure? 1A. Open in a separate window Figure 1 Construction G007-LK and verification of pSA-Hp24-6His vector. We PCR amplified the p24 gene from pNL4.3 and cloned at DNA polymerase (Thermo Scientific #EP0572) following manufacturers supplied protocol. The PCR product (714 bp amplicon) was purified using NucleoSpin? Gel and PCR Clean-up kit (MACHEREY-NAGEL GmbH & Co #740609) and restricted with polymerase. The PCRed plasmid (5.914 kb) was gel purified G007-LK using NucleoSpin? Gel and PCR Clean-up kit and restricted with cells, and selected on LB-agar plates (containing 100 ug mL-1 Ampicillin) after 18 h incubation at 30C. A total of 10 randomly selected bacterial colonies were subjected to colony PCR using a vector-specific primer T7Up-F (5 GATCCCGCGAAATTAATACG 3) and an insert-specific primer P24-R (5 GTGGAGCTCCAAAACTCTTGC 3). Amplification of a 806 bp PCR product will be confirmatory for the successful cloning of P24 insert in pSA vector. Plasmid DNA was isolated from 3 colony PCR-positive clones and subjected to restriction analysis and DNA sequencing. We named this recombinant plasmid pSA-Hp24-6His. Expression of capsid protein p24 in pSA-HP24-6His-transformed NiCo21(DE3) E. coli Sequencing-confirmed pSA-Hp24-6His was transformed into chemically competent NiCo21(DE3) and transformants were selected on LB-Agar containing 100 g mL-1 Ampicillin. For expression, a single colony from a freshly streaked (~18h) plate was inoculated in 10 mL of Ampicillin-supplemented LB broth. The starter culture was grown at 30C while shaking at 250 rpm until the OD600 was approximately 1. The bacterial cells were centrifuged at 3000 g for 10 min, re-suspend in fresh LB broth, and used to inoculate the main culture at 1:20 dilution (0.5 OD600). The culture was grown at 30C while shaking at 250 rpm until the OD600 reached to 0.5-0.6. The cultures were then equilibrated to induction temperature (30, 22, or 18C) and induced with various concentrations of Isopropylthio–galactoside (IPTG). Induced cultures were grown for different time lengths (6 hours at 30C; 12 hours at 22C; 16 hours at 18C) and bacterial cells were pelleted by centrifugation at 5000??g for 10 minutes in pre-weighed centrifuge tubes/bottles. Expression of HIV-1 CA in NiCo21(DE3) transformed with pACYC-RIL, pRARE2, and pLysSRARE2 The NiCo21(DE3) were individually transformed with pACYC-RIL, pRARE2, and pLysSRARE2 vectors and the transformants were selected on LB agar plates containing 25 g mL-1 Chloramphenicol. Transformants were grown out and competent cells were prepared following Inoues protocol [17]. The pACYC-RIL, pRARE2, and pLysSRARE2-containing NiCo21(DE3) were then transformed with pSA-Hp24-6His vector and the transformants were selected on LB agar plates containing Ampicillin (100 g mL-1) and Chloramphenicol (25 g mL-1). Cultures were grown in presence of both the antibiotics and the expression.